Information In Noncoding For ENCR40010016

Accession Number:  ENCR40010016	Category:   suhB
Cross-Ref:   Nondisruptable_sequence_ID: CCNA_99934; Rfam: RF00519	Description:   sRNA (CCNA_R0014); suhB
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:543.

Nucleotide sequence:   GUGAGCUUCAAAAAAAUGACGUCGAACGUUUGUUUUCCGCUUGCCUAAUUUUGCGCCGCACUCUAAAAACAAUCCUGUGAGGCGGCGCUGCCGCUUCUGCCCUUCCUGGGCGUUUCCUCCCUAAUGAACUGGCCCGGCGGUUUCGCCGGGCUUUUUUUUGGAUUCGGCCCCGGGGCCCAGUCCCCAUAGCGG

Molecular structure In Noncoding For ENCR40010016

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -72.9 kcal/mol is given below.

((((((...((((....(((((...)))))..))))..))))))........(((((((.(((...............))))))))))..(((((...((((.....))))((((..........)))).(((((((((....))))))))).......(((((.((((....)))).)))))....))))) (-72.90) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -75.81 kcal/mol.

The frequency of the MFE structure in the ensemble is 0.89 %.

The ensemble diversity is 17.30

((((((...,{(({,..(((((...)))))..)))}..))))))........(((((((.(((.....,,......,,))))))))))..(((((..,((((.....))))|.............|||..(((((((((....))))))))).......(((((.((((....)))).)))))....))))) [-75.81]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -71.40 kcal/mol is given below.

((((((...........(((((...)))))........))))))........(((((((.(((...............))))))))))..(((((...((((.....))))...................(((((((((....))))))))).......(((((.((((....)))).)))))....))))) {-71.40 d=10.62} [ VIEW IN FORNA ]