Information In Noncoding For ENCR40010017

Accession Number:  ENCR40010017 Category:   tRNA
Cross-Ref:   Nondisruptable_sequence_ID: CCNA_99986; Rfam: RF00005 Description:   tRNA (CAA) (CCNA_R0022)
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:544.
Nucleotide sequence:   GUCGGGAGGCCUGAAAAAAGUUCUGAAAAGGUCGUUGCAUCCAUCCGAGUCGUGAGCUAUCUCCACCGCCUCGCCGGGCCCUGAGGGGUCUCGCCGUUCCUGCUGGGGAAUGGUGUAAUGGUAACACUGCGGUUUUUGGUACCGUCAUUCUAGGUUCGAGUCCUAGUUCCCCAGCCACUUC


Molecular structure In Noncoding For ENCR40010017

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -57.5 kcal/mol is given below.
..((((((((.((.....((((((((...((.............))...))).))))).....))..))))).)))(((((....)))))...........(((((((((.(((((.......)))))(((((.......)))))....(((((.......))))))))))))))...... (-57.50) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -59.65 kcal/mol.
The frequency of the MFE structure in the ensemble is 3.06 %.
The ensemble diversity is 28.51
..((((((((.{,.....((((((((...((.............))...))).)))))...,,,,..))))).}})|{{{{.,,,))))),,.}},.....(((((((({.(((((.......)))))(((((.......)))))....(((((.......)))))}))))))))...... [-59.65]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -54.80 kcal/mol is given below.
...(((((((........((((((((...((.............))...))).))))).........))))).)).(((((....)))))...........(((((((((.(((((.......)))))(((((.......)))))....(((((.......))))))))))))))...... {-54.80 d=18.60} [ VIEW IN FORNA ]