Information In Noncoding For ENCR40010018

Accession Number:  ENCR40010018	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0024	Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:545.

Nucleotide sequence:   UUUAAGCGCGCCUGCAGGGUAAACAUAUAUUAUCGUUAAAAUCUAGGUUGUUCAUGUCUGUACUUGAUGAACGCUGCCUAUACUAUUCUUGUGAAAACUAUAGAAAGAGCGUUUAGGUACUGGUGCUGUGGGCAAAACGCCCACCGGUCGUCAAAACGACACCGGCAACCUCCAAAG

Molecular structure In Noncoding For ENCR40010018

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -46.8 kcal/mol is given below.

.........((((...))))........................(((((((.(((....(((((...((((((((..(((((...(((....)))...)))))....)))))))))))))..)))..((((((.....))))))((((.(((.....))))))))))))))...... (-46.80) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -50.23 kcal/mol.

The frequency of the MFE structure in the ensemble is 0.38 %.

The ensemble diversity is 33.29

.....{{{,,{{{,,.}|||.,.......,,},}.,,.......(((((((..,,,,{.((((({,.,{((((((..(((((...(((....)))...)))))....))))))))))))).}}}}|.((((((.....))))))((((.(((.....))))))))))))))...... [-50.23]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -43.60 kcal/mol is given below.

............................................(((((((........((((((...(((((((..(((((...(((....)))...)))))....))))))))))))).......((((((.....))))))((((.(((.....))))))))))))))...... {-43.60 d=20.43} [ VIEW IN FORNA ]