Information In Noncoding For ENCR40010019

Accession Number:  ENCR40010019	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0041	Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:546.

Nucleotide sequence:   UUGUAGGCUUUGAGACCGCUUCUGCGAUCGUUAGCCAGAUGAAUAGCAGCGAUGCGUUUUUAAUCUGUGAAUCGGAACGUCAAUUUCUGAAUGUUGGUUACCAAUAUGGUAACAAGAUUAGUAUUGCGAUCUAUAUUUGCUAAAUUUGGACGGCAUAUUUUUGUCGGUGUUGGCU

Molecular structure In Noncoding For ENCR40010019

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -43.8 kcal/mol is given below.

.....((((....((.(((....))).))...))))......((((..(((((((.....((((((.....((((((.......))))))......(((((((...))))))).)))))))))))))...))))....(((((.......(((((......)))))...))))). (-43.80) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -46.34 kcal/mol.

The frequency of the MFE structure in the ensemble is 1.63 %.

The ensemble diversity is 51.66

.....((((....((.(((....))).))...)))),,{{,,{{(({,{((((((..,,,{,{{{{,....{{((({{{.{{,,.,||}|,{.|{.(((((({...})))))),)})))))}))))),.,))},,,,,{{{{{.......(((((......)))))...))))). [-46.34]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -33.90 kcal/mol is given below.

.....((((....((.(((....))).))...))))............(((((((.........................................(((((((...))))))).......)))))))...........(((((.......(((((......)))))...))))). {-33.90 d=34.47} [ VIEW IN FORNA ]