Information In Noncoding For ENCR40010020

Accession Number:  ENCR40010020 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0052 Description:   upstream of nuoA (CCNA_02033)
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:547.
Nucleotide sequence:   UUCAAACACCCGGCGCACAUUGAGAAACGUUCGCAACGAGAGACGUUUUGUCGGUUCUUCGAGAUGGCCGUUGACACGAGUCUUCACCCGACAUAUCAGACGCGCCUCGCCGAUUGGCGGGUCGCACUUUCGCCUCGGCGAAGGGGUAUGCGGAUGUAGCUCAGUUGGUUAGAGC


Molecular structure In Noncoding For ENCR40010020

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -60.1 kcal/mol is given below.
..........((((.((..((((((..((..((.((((.....)))).)).))..)).))))..))))))((((((((((.((.((.(((.((((((....(((.((((((....)))))).))).(((((((....)))))))))))))))).)).))))).))..)))))... (-60.10) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -63.33 kcal/mol.
The frequency of the MFE structure in the ensemble is 0.53 %.
The ensemble diversity is 54.79
..........{(((.((..(((((,.{((,,((,((((.....}}}}.}|,||,|}},,}}},,}}}}}|{,{{,|||{|}|{,|{.{{{.{{{{{{....(((.((((((....)))))).))).(((((((....)))))))}))}))))),)),,}))),)),}))}..... [-63.33]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -45.00 kcal/mol is given below.
..........((((.(...(((.............(((.....))).............)))...))))).......(((....((.(((.((((((....(((.((((((....)))))).))).(((((((....)))))))))))))))).))...)))............. {-45.00 d=39.86} [ VIEW IN FORNA ]