Information In Noncoding For ENCR40010021

Accession Number:  ENCR40010021 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0093 Description:   origin of replication (gap1)
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:548.
Nucleotide sequence:   GCCCGGACGUCCCUUAAGAUCUUUCUAACAUAUAUUAAUAAGAAAUUAAGAUUGAAGGAGGGAGCGGAAGGGCAACUGCAAAGUGGGGAAAACCCCUGUGAGGCGAGUGACUCGCACAGCCCGUCCCGGCUUUCCCCCAGGCCUUCCCACAUGGGGUUAACGCUCUGUUAAUC


Molecular structure In Noncoding For ENCR40010021

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -53.2 kcal/mol is given below.
((((...((((((((..((((((.......(((....))).......))))))....)))))).))...))))....(((.((((.....((((((((((.(((..(((.....))).)))......(((((......)))))....)))).))))))..)))).)))..... (-53.20) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -57.36 kcal/mol.
The frequency of the MFE structure in the ensemble is 0.12 %.
The ensemble diversity is 51.86
((((...((((((((..(((((({{{....,......,,.}}}....})))))....)))))).))...))))..,,..,.|||((((,...|}}|(((({{,{,,{...)))))),,},,..}}},}))}},.{{{{{||....,||...})))){{{{{|,..}))}},.. [-57.36]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -31.60 kcal/mol is given below.
((((...((((((((..(((((((((..............)))....))))))....)))))).))...)))).............................................................(((((............))))).((((.....))))... {-31.60 d=35.42} [ VIEW IN FORNA ]