Information In Noncoding For ENCR40010022

Accession Number:  ENCR40010022 Category:   tRNA
Cross-Ref:   Nondisruptable_sequence_ID: CCNA_99990; Rfam: RF00005 Description:   tRNA (CGU) (CCNA_R0008)
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:549.
Nucleotide sequence:   AAUUAUCCUUCAAACCGGGCUUGCGUCCCCGGAAUGGCUGGGCUAUCUCCCCCGCCUCGCCGCAAGGCAGUGCGCGCCCGUAGCUCAGCUGGAUAGAGCAUCAGACUACGAAUCUGAGGGUCGGACGUUCGAAUCGUUCCGGGCGCGCCAUUCUUCCCAAAGCUCGAAAC


Molecular structure In Noncoding For ENCR40010022

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -63.7 kcal/mol is given below.
...............(((((((((((.(((((((((((((((((((......(((((.(((....))))).))).....))))))))))).(((.((((.((.((((.((....))..)))).)).))))..))))))))))).))))...........))))))).... (-63.70) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -64.89 kcal/mol.
The frequency of the MFE structure in the ensemble is 14.55 %.
The ensemble diversity is 5.38
...............(((((((((((.(((((((((((((((((((......(((((.(((....))))).))).....))))))))))).(({.((((.((.((((.(,....,)..)))).)).))))..})))))))))).))))...........))))))).... [-64.89]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -63.50 kcal/mol is given below.
...............(((((((((((.(((((((((((((((((((......(((((.(((....))))).))).....))))))))))).(((.((((.((.((((.(......)..)))).)).))))..))))))))))).))))...........))))))).... {-63.50 d=3.42} [ VIEW IN FORNA ]