Information In Noncoding For ENCR40010024

Accession Number:  ENCR40010024 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0042 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:551.
Nucleotide sequence:   ACAGAGCGCCUCCCUCGCGGCCGUGAAUUCGCGCCGCGAAAUCUUGGCGGCUGGAGUCGAUGAUUGGCUGGAUUGAGUUGAUAGAGUCUUUCAACCGAGGCCGGCCAAGCUGGUUCGUGAGGGUGAAUCUGGGAUUUAGAGUAAAGUGUCGCAGUUCAACUCACCAGCC


Molecular structure In Noncoding For ENCR40010024

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -66.4 kcal/mol is given below.
.(((..((((....(((((((.(((....))))))))))......)))).)))..........((((((((.(((.(((((.((...)).))))))))..))))))))((((((....(((..((((.(((.(((............))).))))))).))))))))). (-66.40) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -68.9 kcal/mol.
The frequency of the MFE structure in the ensemble is 1.72 %.
The ensemble diversity is 22.37
.(((..((((....(((((({{(((....))))))))))......)))).)))..........((((((((.(((.(((((.{{...}}.))))))))..))))))))((((({..,{(((..((((.(((.(((............))).))))))).))))))))). [-68.90]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -66.30 kcal/mol is given below.
.(((..((((....(((((((.(((....))))))))))......)))).)))..........((((((((.(((.(((((.((...)).))))))))..))))))))(((((....((((..((((.(((.(((............))).))))))).))))))))). {-66.30 d=13.96} [ VIEW IN FORNA ]