Information In Noncoding For ENCR40010026

Accession Number:  ENCR40010026 Category:   tRNA
Cross-Ref:   Nondisruptable_sequence_ID: CCNA_99988 Description:   tRNA (GUC) (CCNA_R0015)
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:553.
Nucleotide sequence:   GCUUGCGCAGUCCGCGAGCCGCCGCUAUACCCCCACACCUUCCCGGCCGGGACGUCUUCACGAAGACGCUUCGGAUCGCUUCGGCGGACGCGUAGCUCAGCGGGAGAGCACUACGUUGACAUCGUAGGGGUCACAGGUUCAAUCCCUGUCGCGUCCACCAUUCC


Molecular structure In Noncoding For ENCR40010026

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -55.4 kcal/mol is given below.
(((((((.....)))))))........................((((((((.((((((....)))))).))))).)))....((.(((((((..((((.......)))).(((((.......))))).....(((((.......)))))))))))).))..... (-55.40) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -57.06 kcal/mol.
The frequency of the MFE structure in the ensemble is 6.74 %.
The ensemble diversity is 38.98
(((((((.....))))))).{{{{...................{||(((((.((((((....)))))).))))).}})...,||}(((((((..((((.......}}}}.(({{(..,....}}}}},.,,.(((((.......)))))))))))).},..... [-57.06]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -49.70 kcal/mol is given below.
(((((((.....)))))))...........................(((((.((((((....)))))).)))))...........(((((((..((((.......)))).(((((.......))))).....(((((.......))))))))))))........ {-49.70 d=25.16} [ VIEW IN FORNA ]