Information In Noncoding For ENCR40010027

Accession Number:  ENCR40010027 Category:   tRNA
Cross-Ref:   Nondisruptable_sequence_ID: CCNA_99964; Rfam: RF00005 Description:   tRNA (CUC) (CCNA_R0052)
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:554.
Nucleotide sequence:   CUUGGUGCGGUCGAGAAGACUCGAACUUCCACGGGUUGCCCCACAGCGACCUCAACGCUGCGCGUCUACCAAUUCCGCCACGACCGCUCGUGGUGAGGGGCGGCUGGUAGCAAACUGAAUCGGCUUUGGGAAGCCGGAAGUUCGAGAAUGUCGAACUCAAGCC


Molecular structure In Noncoding For ENCR40010027

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -66.9 kcal/mol is given below.
...(((..((((((.....(((((((((((((.(((((((((.(((((.......)))))...............((((((((....)))))))).))))))))).)).............(((((....))))))))))))))))....))).)))...))) (-66.90) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -68.91 kcal/mol.
The frequency of the MFE structure in the ensemble is 3.85 %.
The ensemble diversity is 30.41
...(((..((((((.....((((((((((({{.(((((((((.{((({.......}||||,..,,,..,,.....((((((((....)))))))).))))})))}.)),},..........(((({....})))))))))))))))....)))},)},..))) [-68.91]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -66.90 kcal/mol is given below.
...(((..((((((.....(((((((((((((.(((((((((.(((((.......)))))...............((((((((....)))))))).))))))))).)).............(((((....))))))))))))))))....)))).))...))) {-66.90 d=21.29} [ VIEW IN FORNA ]