Information In Noncoding For ENCR40010028

Accession Number:  ENCR40010028	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0076	Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:555.

Nucleotide sequence:   UCGUGAAACUACGCGGCCUGUCAAUAGGUCUGACGUCGAGGUCAGACCUAUUGACAGGCGGGGAUCAGACGCCAUUGCCGCUGAAAUCCCGUGGAAAAAUGGAACUCCAGAGCGCCGAACGGCCGGAAAACGCCUUUUGAGGCGGAAGGUUGUCGC

Molecular structure In Noncoding For ENCR40010028

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -71.7 kcal/mol is given below.

.((((......))))(((((((((((((((((((......))))))))))))))))))).((((((((..((....))..))))..)))).(((.....(((....))).....))).((((((......(((((....)))))...))))))... (-71.70) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -73.79 kcal/mol.

The frequency of the MFE structure in the ensemble is 3.35 %.

The ensemble diversity is 14.55

.((((......))))(((((((((((((((((((......))))))))))))))))))).((((((((..((....))..))))..)))).{({.....(((....)))...,,)|{.{(((((......(((((....)))))...)))))))}. [-73.79]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -71.40 kcal/mol is given below.

.((((......))))(((((((((((((((((((......))))))))))))))))))).((((((((..((....))..))))..))))..((.....(((....))).....))(.((((((......(((((....)))))...))))))).. {-71.40 d=9.50} [ VIEW IN FORNA ]