Information In Noncoding For ENCR40010030

Accession Number:  ENCR40010030	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0044	Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:557.

Nucleotide sequence:   GUCCAAGUCGAGCGAUUGAGCCGGAAUUGCCGAGAACAUGGCCUUUUGCGUCAGCCGGACAACGUUGUCAUUGGAAUUAUUUGCCGAAUUCUCCUGUUAUCGCCCGGAACGCUAACCGCCAGUGGACGCGUUCUUGACCGAAGUGCUACUG

Molecular structure In Noncoding For ENCR40010030

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -37.3 kcal/mol is given below.

(((((..(((.((((((.......))))))))).....((((.....((((...((((....((....((..((((((........))))))..))....)).)))).)))).....)))).)))))((((((......))).)))..... (-37.30) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -39.7 kcal/mol.

The frequency of the MFE structure in the ensemble is 2.04 %.

The ensemble diversity is 21.39

((((,..(((.((((((.......)))))))))...,.((((..,,.((((...((((....((.,,.((..((((((........))))))..)).,,.)).)))).))))..,..))))|}))))(({(((......))),)))..... [-39.70]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -36.40 kcal/mol is given below.

((((...(((.((((((.......))))))))).....((((.....((((...((((....((....((..((((((........))))))..))....)).)))).)))).....))))..))))((((((......))).)))..... {-36.40 d=13.37} [ VIEW IN FORNA ]