Information In Noncoding For ENCR40010031

Accession Number:  ENCR40010031 Category:   tRNA
Cross-Ref:   Nondisruptable_sequence_ID: CCNA_99956; Rfam: RF00005 Description:   tRNA (UGC) (CCNA_R0060)
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:558.
Nucleotide sequence:   CUGUAUCGAACCCCCUCCCCCGCCGACGUGAUUUGCGUCGACACCCGGAUGGCCCGGUGGCGGAGUGGUGACGCAGCGGACUGCAAAUCCGUGCACGCCGGUUCGAUUCCGGCCCGGGCCUCCAUCAUUGUUGCAAUCACUUAGCC


Molecular structure In Noncoding For ENCR40010031

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -51.7 kcal/mol is given below.
.....................((.((.((((((.(((.(((.....(((.((((((((((((((.(((((..(((.((((.......))))))).))))).))))...)))..))))))))))....))).))))))))))).)). (-51.70) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -53.96 kcal/mol.
The frequency of the MFE structure in the ensemble is 2.55 %.
The ensemble diversity is 13.11
.....................((.((.(((({{{(({.(((.....(((.((((((((((((((.(((((..(({,((((.......))))))).))))).))))...))}..))))))))))....))).))))))))))).)). [-53.96]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -51.70 kcal/mol is given below.
.....................((.((.(((((.((((.(((.....(((.((((((((((((((.(((((..(((.((((.......))))))).))))).))))...)))..))))))))))....))).))))))))))).)). {-51.70 d=8.32} [ VIEW IN FORNA ]