Information In Noncoding For ENCR40010032

Accession Number:  ENCR40010032	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0039	Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:559.

Nucleotide sequence:   GUUACGACUGCUUCAUGACGUCGAAUUAAGUCUAUGAAAAAGAAGUCAUAAUUGGUGGGCGCUUGGGAGUGGGCUGCUGCCCGCCCAGUCUUCGUAAAUGAUUAACCGCAAAACUUGGGUCUUCGUUAGCGCACUUCUGAGA

Molecular structure In Noncoding For ENCR40010032

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -37.8 kcal/mol is given below.

.....((((.(((((((((..........))).))))...)).))))....((((.(((((((..((.((((((....))))))))..........(((((...(((.(((...))))))..)))))))))).)).)))).. (-37.80) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -41.12 kcal/mol.

The frequency of the MFE structure in the ensemble is 0.46 %.

The ensemble diversity is 35.71

.{{{.((((.{((((((((..........))).)))),..}).)))).}},|{((.(((((((,{((,{(((((....))))))))|,,.......{((((...{((.{{,...,)))))..)))))))))).)).)))}.. [-41.12]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -26.60 kcal/mol is given below.

..((.((((.(.(((((((..........))).))))....).)))).))..(((.(((((((......(((((....))))).............(((((...(((.((.....)))))..)))))))))).)).)))... {-26.60 d=24.03} [ VIEW IN FORNA ]