Information In Noncoding For ENCR40010035

Accession Number:  ENCR40010035 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0074 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:562.
Nucleotide sequence:   CCUAAAGCAAUAACAGAGCGGCGAAUCGCGUUAAAAUCUCCGCUAUCUACUAAAGAAGCACGCCGCAGUAACAAAGUUAUCCGAAAUAUAUCCUUGGAUUUAUCAAUUCUAUUUGGAAAGAUUCACGACCAUUUCAAC


Molecular structure In Noncoding For ENCR40010035

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -19.5 kcal/mol is given below.
.................((((((....(((..........)))..(((.....)))....)))))).(((((...)))))..(((((...((..(((((((.((((......))))..))))))).))..)))))... (-19.50) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -21.61 kcal/mol.
The frequency of the MFE structure in the ensemble is 3.25 %.
The ensemble diversity is 17.62
.................((((((....{{{..........,||,.(((.....)))}}}.)))))).{{{{{...)))}}..(((((...{(..(((((((.((((......))))..))))))).)}..)))))... [-21.61]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -15.80 kcal/mol is given below.
.................((((((......................(((.....)))....)))))).(((((...)))))..(((((...((..(((((((.((((......))))..))))))).))..)))))... {-15.80 d=12.14} [ VIEW IN FORNA ]