Information In Noncoding For ENCR40010036

Accession Number:  ENCR40010036 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0080 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:563.
Nucleotide sequence:   CCCCGAAAACACGAUCAAUUUCGCCGACUGCACUUAAUGGCCAGUAAACAGCGAAUAGUUUUCAGAGAUUUUCUUUUGGUUUAUUUGUAUUUACCGUUAUUUGUUCUUAACCAUGCACUCCGCGAUCGCUGCCAAGC


Molecular structure In Noncoding For ENCR40010036

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -23 kcal/mol is given below.
....................((((.((.((((...((((((..(((((..((((((((...((((((......)))))).)))))))).))))).))))))............)))).)).))))..(((....))) (-23.00) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -25.65 kcal/mol.
The frequency of the MFE structure in the ensemble is 1.36 %.
The ensemble diversity is 22.35
...........,,.......((((.((.((((...((((((..(((((..((((((((...{(((((,...,})))})).)))))))).))))).)))))}.,.....,,...)))).)).))))..(((....))) [-25.65]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -21.40 kcal/mol is given below.
....................((((.((.((((...((((((..(((((..((((((((...((((((.....)).)))).)))))))).))))).))))))............)))).)).))))..(((....))) {-21.40 d=14.95} [ VIEW IN FORNA ]