Information In Noncoding For ENCR40010038

Accession Number:  ENCR40010038 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0029 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:565.
Nucleotide sequence:   CGGGAAGCUCCUUGGCUUGAAAUCGUACGAACGAUUUAAUCGUGUGCGAUAUAAAUUCAAGAGGUGGGGUGCGAAAAAGAUCGUGCGCGAUCGAAUUGUUGUCAGCGCCCCCGGGUUGGCAAGCGUCGAUCG


Molecular structure In Noncoding For ENCR40010038

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -45.5 kcal/mol is given below.
......(((((....(((((((((((((..(((((...)))))))))))).....))))))....)))))((((......))))...(((((((....((((((((.((...))))))))))...))))))) (-45.50) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -47.64 kcal/mol.
The frequency of the MFE structure in the ensemble is 3.11 %.
The ensemble diversity is 21.38
......,{{((,...(((((((((((((..(((((...)))))))))))).....))))))....)))||((((......))))}}.(((((((....((((((((.{{...)}))))))))..,))))))) [-47.64]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -44.90 kcal/mol is given below.
........(((....(((((((((((((..(((((...)))))))))))).....))))))....)))((((((......)))))).(((((((....((((((((.((...))))))))))...))))))) {-44.90 d=13.85} [ VIEW IN FORNA ]