Information In Noncoding For ENCR40010040

Accession Number:  ENCR40010040 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0053 Description:   upstream of CCNA_02064
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:567.
Nucleotide sequence:   CGUCGCUGCGUCGCGGCAAAGCAAAGUCUGUUUCGGAUUGUUACCACAUAAGAGGCUGUAUUUAUUUCAUUUUUACAACAGGCGCACGCCCCUGGAAACGGAACGCGGAUCGAUGACCGACGCUCUGGCGA


Molecular structure In Noncoding For ENCR40010040

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -31.4 kcal/mol is given below.
(((((..(((((((((....((....((((((((.........((........)).((((.............)))).((((........))))))))))))..))...))).....))))))..))))). (-31.40) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -33.67 kcal/mol.
The frequency of the MFE structure in the ensemble is 2.52 %.
The ensemble diversity is 31.15
(((((..(((((((({....((....(((((((({{...,...{|........}}.((({.............))}}.,,(({....}}}})}}))))))))..))...}}}.....))))))..))))). [-33.67]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -28.30 kcal/mol is given below.
(((((..((((((((.....((....((((((((......................((((.............))))...(((....)))....))))))))..))....)).....))))))..))))). {-28.30 d=20.33} [ VIEW IN FORNA ]