Information In Noncoding For ENCR40010041

Accession Number:  ENCR40010041 Category:   tRNA
Cross-Ref:   Nondisruptable_sequence_ID: CCNA_99969; Rfam: RF00005 Description:   tRNA (UCA) (CCNA_R0043)
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:568.
Nucleotide sequence:   CUCCGGACAGGUGGCCGAGUGGUUUAAGGCAGCGGUCUUGAAAACCGCCGUAGGUGGAAGCCUACCGUGGGUUCGAAUCCCACCCUGUCCGCCAGAAUUCCAAGUUUCUUGUAAAAUCAGAGUCUUAGCG


Molecular structure In Noncoding For ENCR40010041

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -42.5 kcal/mol is given below.
...((((((((.((.((.((..((((((((....)))))))).))))))((((((....)))))).(((((.......)))))))))))))..........(((.(((.((......))))).))).... (-42.50) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -46.01 kcal/mol.
The frequency of the MFE structure in the ensemble is 0.34 %.
The ensemble diversity is 26.57
...((((((((.,,.,{.(({{((((((((....))))))},.))))))((((((....)))))).(((((.......)))))))))))))..,|,.....{{(.|{||,|......,}))}.}},.... [-46.01]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -37.70 kcal/mol is given below.
...((((((((.......((((((((((((....)))))))..))))).((((((....)))))).(((((.......)))))))))))))............(..((...........))..)...... {-37.70 d=17.99} [ VIEW IN FORNA ]