Information In Noncoding For ENCR40010042

Accession Number:  ENCR40010042 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0075 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:569.
Nucleotide sequence:   UCUGAGCUUGUCGAAGGACGAGGAUUUCCAGCCGGCCUCGCGCCGAAAUCUUGGCGACGAAGCCUUUUCCCCGGGGGAAGGCACGUUUGCAGCCGGAUCGGUAGCGAAAUGCGUCACGCGUGCAAACAC


Molecular structure In Noncoding For ENCR40010042

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -48.3 kcal/mol is given below.
......((((((....))))))........((((((.(((((((((....)))))).))).)))..(((((...))))))))..(((((((..(((((..(((......)))))).))..))))))).. (-48.30) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -49.86 kcal/mol.
The frequency of the MFE structure in the ensemble is 7.96 %.
The ensemble diversity is 18.47
......((((((....))))))........((((((.(((((((((....)))))).))).)))..(((((...))))))))..(((((((..(((({,,{{{......)))))).))..))))))).. [-49.86]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -43.10 kcal/mol is given below.
......((((((....))))))........((((((.(((((((((....)))))).))).)))..(((((...))))))))..(((((((..((((....((......))..)).))..))))))).. {-43.10 d=11.29} [ VIEW IN FORNA ]