Information In Noncoding For ENCR40010044

Accession Number:  ENCR40010044 Category:   tRNA
Cross-Ref:   Nondisruptable_sequence_ID: CCNA_99993; Rfam: RF00005 Description:   tRNA (ACG) (CCNA_R0001)
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:571.
Nucleotide sequence:   CUCUGGAGCGCCCGCUUCGGAGCCCGUGGGCCGCCUUAGCUCAGCCGGUAGAGCGGCGCAUUCGUAAUGCGUAGGUCAGGUGUUCGAGUCACCUAGGCGGCACCACUUUUUACAUGAAGAAAAGUAC


Molecular structure In Noncoding For ENCR40010044

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -51.3 kcal/mol is given below.
(((((((((....)))))))))...(((((((((((..((((........)))).(((((((...))))))).....(((((.......)))))))))))).))))..................... (-51.30) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -52.58 kcal/mol.
The frequency of the MFE structure in the ensemble is 12.6 %.
The ensemble diversity is 8.33
(((((((((....)))))))))...(((((((((((..((((........)))).(((((((...))))))).....(((((.......)))))))))))).)))){{{{{......,}},...... [-52.58]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -51.30 kcal/mol is given below.
(((((((((....)))))))))...(((((((((((..((((........)))).(((((((...))))))).....(((((.......)))))))))))).))))..................... {-51.30 d=4.70} [ VIEW IN FORNA ]