Information In Noncoding For ENCR40010045

Accession Number:  ENCR40010045 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0001 Description:   origin of replication (gap2)
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:572.
Nucleotide sequence:   ACCGGACUCGUUCCGCGUCUUUGGACAAUCGGGAUUCAGACUUCGGGGGAUGCGGCGCAGGCUUGGGGAUGAUAGGCGAGCAAUGCGACCGUUGAUCACAGCGGCGCCGUGUCACGACGCUGUUG


Molecular structure In Noncoding For ENCR40010045

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -47.3 kcal/mol is given below.
.(((((.((((((((.(((....)))...))))))...)).)))))..(((((((((((.(((((...........)))))..)))).))))..))).((((((((.(((...))).)))))))) (-47.30) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -48.23 kcal/mol.
The frequency of the MFE structure in the ensemble is 22.13 %.
The ensemble diversity is 5.31
.(((((.((((((((.(((....)))...))))))...)).))))),,{,,((((((((.(((((...........)))))..)))).))))..,)).((((((((.(((...))).)))))))) [-48.23]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -46.20 kcal/mol is given below.
.(((((.((((((((.(((....)))...))))))...)).))))).....((((((((.(((((...........)))))..)))).))))......((((((((.(((...))).)))))))) {-46.20 d=3.71} [ VIEW IN FORNA ]