Information In Noncoding For ENCR40010047

Accession Number:  ENCR40010047 Category:   tRNA
Cross-Ref:   Nondisruptable_sequence_ID: CCNA_99972; Rfam: RF00005 Description:   tRNA (CCA) (CCNA_R0038)
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:574.
Nucleotide sequence:   CUGUAGAGCAGCCGCCUGCUGAUGUUUCGGAGCGUAGCGCAGCCUGGUAGCGCAUCUGUUUUGGGAGCAGAGGGUCGCAGGUUCAAAUCCUGCCGCUCCGACCAUCGGUAAGGCACUUUGGGAG


Molecular structure In Noncoding For ENCR40010047

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -49.8 kcal/mol is given below.
((((...))))..(((((((((((..((((((((..((((.........)))).(((((((...))))))).....(((((.......))))))))))))).))))))).)))).......... (-49.80) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -51.6 kcal/mol.
The frequency of the MFE structure in the ensemble is 5.43 %.
The ensemble diversity is 10.62
((((...})}},,(((((((((((..((((((((..((((.,,...,,.)))).(((((((...))))))).....(((((.......))))))))))))).)))))))},))).......... [-51.60]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -49.80 kcal/mol is given below.
((((...))))..(((((((((((..((((((((..((((.........)))).(((((((...))))))).....(((((.......))))))))))))).)))))))).))).......... {-49.80 d=7.03} [ VIEW IN FORNA ]