Information In Noncoding For ENCR40010048

Accession Number:  ENCR40010048 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0020 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:575.
Nucleotide sequence:   UCCAAUCCCUUUACAGAAAACACCCCUAUCAAUUGUAACCAUCCAAAUACCAAAAGUAUUCCGAUAGUCCAAUUAAGGAUUUGGGUGAAUUGCAAGGUUGCCCUUUUUGUCAUGGUCAUGAUC


Molecular structure In Noncoding For ENCR40010048

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -21.4 kcal/mol is given below.
.......((...(((((((.(((((..((((((((..((.(((..(((((.....)))))..))).)).)))))...)))..)))))....(((....)))..)))))))...))........ (-21.40) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -23.23 kcal/mol.
The frequency of the MFE structure in the ensemble is 5.11 %.
The ensemble diversity is 30.19
..,,...((...(((((((.(((((..{{({((((..({,(((,.(((((.....)))))..}}}.}}.}}}}}..,))).,)))))..,,|||}}}.}),..)))))))...))...,}... [-23.23]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -18.40 kcal/mol is given below.
.......((...(((((((.(((((..((((((((..((.(((..(((((.....)))))..))).)).)))))...)))..)))))................)))))))...))........ {-18.40 d=21.00} [ VIEW IN FORNA ]