Information In Noncoding For ENCR40010049

Accession Number:  ENCR40010049 Category:   tRNA
Cross-Ref:   Nondisruptable_sequence_ID: CCNA_99957; Rfam: RF00005 Description:   tRNA (ACC) (CCNA_R0059)
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:576.
Nucleotide sequence:   GCUUGGCGUUCGCGAUUCUCCUCGCUAUACGCCCCCUCCUCGUCGCCGCCGUAGCUCAGUGGUAGAGCGCAUCCUUGGUAAGGCUGAGGUCGGCAGUUCAAUCCUGCCCGGCGGCACCAUGG


Molecular structure In Noncoding For ENCR40010049

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -44.9 kcal/mol is given below.
....(((((..((((......))))...)))))........((.(((((((..((((.......))))....(((((((...)))))))..(((((.......))))))))))))))..... (-44.90) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -46.63 kcal/mol.
The frequency of the MFE structure in the ensemble is 6.07 %.
The ensemble diversity is 14.53
....(((((..((((......))))...)))))....,,..((.(((((((..((((.......}}}),,..(((((((...)))))))..(((((.......))))))))))))}}...)} [-46.63]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -44.90 kcal/mol is given below.
....(((((..((((......))))...)))))........((.(((((((..((((.......))))....(((((((...)))))))..(((((.......))))))))))))))..... {-44.90 d=10.32} [ VIEW IN FORNA ]