Information In Noncoding For ENCR40010050

Accession Number:  ENCR40010050	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0013	Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:577.

Nucleotide sequence:   UUUGAGGCCUUCCUAUUCCGUGGCUAAGUGAAUACAUGAGCAAGUUUUGCGAGAAUAAUUCAGUUUUAAAAUUUAGGCGCGUAUUUUUGAGUAUAGGGAAGCCAUUUUGCUCAUCUAGAU

Molecular structure In Noncoding For ENCR40010050

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -23.4 kcal/mol is given below.

.....(((.(((((((..((((.((((((.......(((((((...)))).........)))........)))))).))))...........))))))).)))................. (-23.40) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -26.34 kcal/mol.

The frequency of the MFE structure in the ensemble is 0.84 %.

The ensemble diversity is 19.88

.....(((.(((((((((((((.((((((,,,.,,.{{{({{,..,|}}}..,,,...}))),,......)))))).)))).......)),,}}))))).)))................. [-26.34]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -22.10 kcal/mol is given below.

.....(((.((((((.((((((.((((((.......((((((.....))).........)))........)))))).)))).......))...)))))).)))................. {-22.10 d=13.33} [ VIEW IN FORNA ]