Information In Noncoding For ENCR40010054

Accession Number:  ENCR40010054	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0012	Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:581.

Nucleotide sequence:   ACCUGAUCCAGUCGAUCAAAAUCUCGGCUGAAGCAUAAAGAUUGCCUACUUCGGCCUCGUGACAUUUGGCCGCACCCCGAGAUCUGGCCGAUUUCGGUCGCGAAAACUAAUCCUGGAU

Molecular structure In Noncoding For ENCR40010054

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -35.4 kcal/mol is given below.

.....((((((..(((....)))..((((((((((.......)))....)))))))(((((((..(((((((............))))))).....))))))).........)))))) (-35.40) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -37.08 kcal/mol.

The frequency of the MFE structure in the ensemble is 6.6 %.

The ensemble diversity is 8.70

.....((((((..(({....,,,..(((((((({{.......}}}...,)))))))(((((((..(((((({............})))))).....))))))).........)))))) [-37.08]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -35.00 kcal/mol is given below.

.....((((((..............((((((((((.......)))....)))))))(((((((..(((((((............))))))).....))))))).........)))))) {-35.00 d=6.03} [ VIEW IN FORNA ]