Information In Noncoding For ENCR40010056

Accession Number:  ENCR40010056 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0056 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:583.
Nucleotide sequence:   GAUUGGCCCGAUCAAAUCCGAUGAAAAGGGUUCUAUUACAGUAGCUUACAGCGGUCUUUGAUCCGAUCACCGCUUGACGCUGAUCGAAGAACGCUCUUGGCGCGUGAAGCCUAGGAG


Molecular structure In Noncoding For ENCR40010056

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -32 kcal/mol is given below.
(((((...)))))....((........))(((((.......(((((((.((((((..(((...)))..))))))))).)))).....))))).(((((((.((.....))))))))) (-32.00) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -34.25 kcal/mol.
The frequency of the MFE structure in the ensemble is 2.61 %.
The ensemble diversity is 40.80
{{{{(,,.|}}||.,,,{{........))}||{,.,....,{,{{,...{(((,({{((({{{||,{{|,,,,.)))}),,))))))))}.)}||(((((,{{.....)))))))}. [-34.25]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -26.00 kcal/mol is given below.
.................((........)).....................(((..((((((((((.(((.....)))))..))))))))..)))((((((.((.....)))))))). {-26.00 d=28.74} [ VIEW IN FORNA ]