Information In Noncoding For ENCR40010058

Accession Number:  ENCR40010058 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0054 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:585.
Nucleotide sequence:   UCCACCGCUUCGCGGUCCCCCUCCCCCGUUUCACGGGGGAGGAUGGCGCUUUUCUCCUCUCCCGCAUCGUGGGGGAGGUGGCGCGCUGCGGAAACGCAGCGUGACGGAGGGGGCGC


Molecular structure In Noncoding For ENCR40010058

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -70.3 kcal/mol is given below.
...(((((...)))))...((((((((((...))))))))))...((.((((((.((((((((((...))))))))))...(((((((((....)))))))))..)))))).)).. (-70.30) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -72.64 kcal/mol.
The frequency of the MFE structure in the ensemble is 2.23 %.
The ensemble diversity is 24.25
...,(({(,,,||}}|,..((((((((((...))))))))))..}||||{,,((,((((((((((...)))))))))).|.(((((((((....))))))))).,))))))))},, [-72.64]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -61.10 kcal/mol is given below.
....((((...))))....((((((((((...)))))))))).............((((((((((...))))))))))...(((((((((....)))))))))............. {-61.10 d=16.16} [ VIEW IN FORNA ]