Information In Noncoding For ENCR40010060

Accession Number:  ENCR40010060	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0091	Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:587.

Nucleotide sequence:   GCGAAACCCGAAAACCGGGGCCCGCCAGAGCGGCCAGCUUCUAGAGAAGUCGGCCAAUCCAGUCAACCGAUUAUUUUGAAGAAACUUCAAAGCAUCGAGUAACUAGACCUUACAU

Molecular structure In Noncoding For ENCR40010060

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -34.2 kcal/mol is given below.

(((...((((.....))))...)))......((((.(((((....))))).))))..((.(((..((((((..((((((((...)))))))).)))).)).))).))........ (-34.20) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -35.48 kcal/mol.

The frequency of the MFE structure in the ensemble is 12.61 %.

The ensemble diversity is 6.55

(((...((((.....))))...)))..{,..((((.(((((....))))).))))..||.{((..((((((..((((((((...)))))))).)))).)).})}.},........ [-35.48]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -33.20 kcal/mol is given below.

(((...((((.....))))...)))......((((.(((((....))))).)))).....(((..((((((..((((((((...)))))))).)))).)).)))........... {-33.20 d=4.59} [ VIEW IN FORNA ]