Information In Noncoding For ENCR40010061

Accession Number:  ENCR40010061	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: CCNA_99914	Description:   sRNA (CCNA_R0074)
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:588.

Nucleotide sequence:   CGGCGAGGCGGCGGGUUCCGCGUUCGGAGACGAGGAGGGCGAAGGGGAAUCCUCCCCCAAGCGGGGGAGGUGUCGCCGCAGGCGACGGAGGGGGAAGUCCUGCUGGCUCGGCCC

Molecular structure In Noncoding For ENCR40010061

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -59 kcal/mol is given below.

.((((((.(((((((((((((.(((.........))).))..........((((((((....))))))))(((((((...))))))).....))))..))))))).))).))). (-59.00) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -60.59 kcal/mol.

The frequency of the MFE structure in the ensemble is 7.63 %.

The ensemble diversity is 12.85

.((((((.(((((((((((((.(((.........))).))..........((((((((....)))))))){((((((...))))))}.....)))}..))))))).)))},)). [-60.59]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -58.40 kcal/mol is given below.

.((((((.(((((((.(((((.(((.........))).))..........((((((((....))))))))(((((((...))))))).....)))...))))))).)))).)). {-58.40 d=8.38} [ VIEW IN FORNA ]