Information In Noncoding For ENCR40010062

Accession Number:  ENCR40010062	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: CCNA_99940	Description:   sRNA (CCNA_R0005) part
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:589.

Nucleotide sequence:   UUGCAUCCUGCGCGAUGAGUCGCGAUAUAGGCCUCGGAGAUCGGCGCGGACGGAGUCCUCGCCAACCUGGUCAGGGCCGAGAGGCAGCAGCCACAACGAGAUCACCUCUGGGU

Molecular structure In Noncoding For ENCR40010062

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -38.2 kcal/mol is given below.

......(((((((((....)))))...)))).(((((((...((((.((((...)))).))))....((((....(((....)))....))))............))))))). (-38.20) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -40.11 kcal/mol.

The frequency of the MFE structure in the ensemble is 4.55 %.

The ensemble diversity is 21.65

..,,..{{{{(((((....)))))...,,})|((((((({{{((((.((((...)))).))))....{(((....(((....)))....)))}......}}},..))))))). [-40.11]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -31.20 kcal/mol is given below.

..........(((((....)))))........((((((..((((((.((((...)))).))))....((((....(((....)))....))))......)).....)))))). {-31.20 d=15.00} [ VIEW IN FORNA ]