Information In Noncoding For ENCR40010063

Accession Number:  ENCR40010063 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0046 Description:   upstream of CCNA_01750
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:590.
Nucleotide sequence:   UCUUCAGGUUCGCAUUGUUCGCGAACCGGAGUAUUUCCGCCGCGCCGCACGGGCUCUUGCCAUCGUGCGCGCGGCGGUUUUCGUUUGAGGCCAAGAUUCGCGGAGGCGCGGAG


Molecular structure In Noncoding For ENCR40010063

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -56 kcal/mol is given below.
.((((.(((((((.......))))))))))).....(((((((((.((((((((....)))..))))))))))))))...................((((((....)))))). (-56.00) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -58.01 kcal/mol.
The frequency of the MFE structure in the ensemble is 3.85 %.
The ensemble diversity is 14.29
.((((.(((((((.......)))))))}))}.....(((((((({{((((((((....)))..)))))))))))))).,{{,....}}}},,,,,.((((((....)))))). [-58.01]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -56.00 kcal/mol is given below.
.((((.(((((((.......))))))))))).....(((((((((.((((((((....)))..))))))))))))))...................((((((....)))))). {-56.00 d=9.44} [ VIEW IN FORNA ]