Information In Noncoding For ENCR40010066

Accession Number:  ENCR40010066 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0068 Description:   upstream of CCNA_02705
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:593.
Nucleotide sequence:   GUCGAAGGCCAUCGAAGGGCAGAAAAAUUCGCGCUUCACACAGCGAGCGUUGCGAAAAUGCCGCUAUAGGUUGCGAUAUUGCACCGCAAAAAACCCCGACCGGAUCCGGAC


Molecular structure In Noncoding For ENCR40010066

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -29.3 kcal/mol is given below.
((((..((((...((((.((.(((...))))).))))....((((.(((((.....)))))))))...)))).)))).((((...))))......(((........))).. (-29.30) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -31.22 kcal/mol.
The frequency of the MFE structure in the ensemble is 4.44 %.
The ensemble diversity is 20.31
((((..{(,,...((((.((.((,...})))).))))....((((.(((((.....)))))))))...||||{||,...|||,,}}},......,,||,|,{....))).. [-31.22]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -18.90 kcal/mol is given below.
.............((((.((.((.....)))).))))....((((.(((((.....))))))))).............................................. {-18.90 d=14.15} [ VIEW IN FORNA ]