Information In Noncoding For ENCR40010067

Accession Number:  ENCR40010067 Category:   tRNA
Cross-Ref:   Nondisruptable_sequence_ID: CCNA_99975; Rfam: RF00005 Description:   tRNA (CCC) (CCNA_R0035)
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:594.
Nucleotide sequence:   GUCGGAGCGUGGCGCAGCCUGGUAGCGCACUUGACUGGGGGUCAAGGGGUCGCAGGUUCGAAUCCUGUCGCUCCGACCAUUUCCUUCGGGAAUAUGCGGAAGAUGAAAGG


Molecular structure In Noncoding For ENCR40010067

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -40.6 kcal/mol is given below.
(((((((((.((((.((((((...((...(((((((...)))))))..))..))))))))...))...)))))))))(((((..((((........)))))))))..... (-40.60) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -42.58 kcal/mol.
The frequency of the MFE structure in the ensemble is 4.01 %.
The ensemble diversity is 19.92
(((((((((.((((.((((({.,.((...(((((((...)))))))..)}.}))))))))...)),,.)))))))))(((((,{{{((........})))}))))..... [-42.58]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -37.90 kcal/mol is given below.
(((((((((.((((.((((((...((...(((((((...)))))))..))..))))))))...))...)))))))))((((....(((........)))..))))..... {-37.90 d=13.49} [ VIEW IN FORNA ]