Information In Noncoding For ENCR40010068

Accession Number:  ENCR40010068 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0008 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:595.
Nucleotide sequence:   UUCUGAGUCGCACGGUAAGAUUGCGGGUUUACUUUCAGGUAACCACGAUCUGCCGCUUUGGUGACUCUCAUUGUGCGGCGAGGGUUUCGCAGAUUCCAUGCGGCGGAGCC


Molecular structure In Noncoding For ENCR40010068

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -37 kcal/mol is given below.
....(((((((.(((((.(((((..((((..((...))..)))).)))))))))).....)))))))...((.(((.(((.(((.((....)).))).))).))).)).. (-37.00) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -39.99 kcal/mol.
The frequency of the MFE structure in the ensemble is 0.78 %.
The ensemble diversity is 27.10
....(((((((,((((,{(((((..((((,{((....)}})))).)))))))))).....)))))))...|{.(((.(((.{((,{(,...}}.})).))).))).)}.. [-39.99]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -36.10 kcal/mol is given below.
....(((((((.((((.((((((..((((.(((....))))))).)))))))))).....)))))))....(.(((.(((.(((..........))).))).))).)... {-36.10 d=18.14} [ VIEW IN FORNA ]