Information In Noncoding For ENCR40010069

Accession Number:  ENCR40010069 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0014 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:596.
Nucleotide sequence:   UAGUAGGUUCAGCUCGACGCUAAAAGGCUUCAGUAUUCCUCUAAACUCGCCACACUCAAAAUGAGUAUAGAUCGCGCCUCUUAGAGUUAUUCGGGGCCGGGGCUCGGGG


Molecular structure In Noncoding For ENCR40010069

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -29.4 kcal/mol is given below.
............(((((.(((....((((((((((...((((((...(((...(((((...))))).......)))....)))))).)))).))))))..)))))))). (-29.40) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -29.98 kcal/mol.
The frequency of the MFE structure in the ensemble is 38.85 %.
The ensemble diversity is 3.19
............(((((.(((....((((((((((...((((((...(((...(((({...})))).......)))....)))))).)))).))))))..)))))))). [-29.98]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -29.40 kcal/mol is given below.
............(((((.(((....((((((((((...((((((...(((...(((((...))))).......)))....)))))).)))).))))))..)))))))). {-29.40 d=1.84} [ VIEW IN FORNA ]