Information In Noncoding For ENCR40010072

Accession Number:  ENCR40010072 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0033 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:599.
Nucleotide sequence:   UUCUGCGCCUACUAGCGCCAUAUAAAAAAUCUAAUAAAUACAGUGUUUGAUCCUGGUUCUUCUCUAUUAGUGGUAGCGUUAUCAUCGCUUGCAGGGAAGGCCUUCGUG


Molecular structure In Noncoding For ENCR40010072

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -21.5 kcal/mol is given below.
....((((......))))..........(((.((((.......)))).)))...(((.(((((((...((((((.........))))))...))))))))))...... (-21.50) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -23.2 kcal/mol.
The frequency of the MFE structure in the ensemble is 6.35 %.
The ensemble diversity is 11.82
....((((......))))..........,{{..,{{.......}}},.}}}...((,{(((((((...((((((.........))))))...))))))))))...... [-23.20]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -15.40 kcal/mol is given below.
....((((......))))............(.................).....((..(((((((...((((((.........))))))...))))))).))...... {-15.40 d=8.31} [ VIEW IN FORNA ]