Information In Noncoding For ENCR40010073

Accession Number:  ENCR40010073	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0047	Description:   upstream of hfq (CCNA_01819)
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:600.

Nucleotide sequence:   CUUUCGGUCGCAAGGCUGGAUGGAAUUUUUCGCUGCGAGCGUGUCGCUUUCGGCGAAAAAUCCUCUAGCAUGACCUUGUUUGUGUGGGGGGCGUGUGGCCCUCCGAGA

Molecular structure In Noncoding For ENCR40010073

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -51.7 kcal/mol is given below.

.....(((((....((((((.(((.((((((((((.(((((...))))).))))))))))))))))))).))))).........((((((((.....))))))))... (-51.70) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -53.21 kcal/mol.

The frequency of the MFE structure in the ensemble is 8.57 %.

The ensemble diversity is 4.19

.....((((,....((((((.(({,((((((((((.(((((...))))).))))))))))))))))))).,)))).........{(((((((.....)))))))}... [-53.21]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -51.70 kcal/mol is given below.

.....((((.....((((((.(((.((((((((((.(((((...))))).)))))))))))))))))))..)))).........((((((((.....))))))))... {-51.70 d=3.08} [ VIEW IN FORNA ]