Information In Noncoding For ENCR40010075

Accession Number:  ENCR40010075	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0079	Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:602.

Nucleotide sequence:   CUCUGAGCGACUGAAGGAACGCCUUCCCAUUCGAUCCAACGAGCUCGCCUAGGGAGAAAAGCGAUAUAAAUCAUAGCUCUAUGGCGCGCUCGAGCGGGUUUGCUG

Molecular structure In Noncoding For ENCR40010075

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -30.7 kcal/mol is given below.

.....((((...(((((....)))))......(((((..(((((.((((...((((......(((....)))....))))..)))).)))))...))))))))). (-30.70) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -32.54 kcal/mol.

The frequency of the MFE structure in the ensemble is 5.05 %.

The ensemble diversity is 16.50

.....(((({..(((((....)))))....,,|{(((..(((((.((((,{{((,{......(({....}))....)))),.)))).)))))...))))}}))). [-32.54]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -23.30 kcal/mol is given below.

.....(((....(((((....))))).......((((..(((((.((((.............(((....)))..........)))).)))))...))))..))). {-23.30 d=12.32} [ VIEW IN FORNA ]