Information In Noncoding For ENCR40010082

Accession Number:  ENCR40010082	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0072	Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:609.

Nucleotide sequence:   UCUUGACCUUCGUCAAAAUGCCUUCUGACAUUUCAGAGGGAAUUAUGAUGAGGGUGUGACCCGAAUGCUGCAGCUUACGUAAAGGGAAUGAUGACCCUUGGG

Molecular structure In Noncoding For ENCR40010082

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -34.9 kcal/mol is given below.

.....((((((((((.(((.((((((((....)))))))).))).))))))))))....(((....((....)).......(((((........)))))))) (-34.90) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -36.7 kcal/mol.

The frequency of the MFE structure in the ensemble is 5.37 %.

The ensemble diversity is 8.24

.....((((((((((.(({.((((((((....)))))))).})).))))))))))..,.(((,...({....}}....,,.{((((........)))))))) [-36.70]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -34.90 kcal/mol is given below.

.....((((((((((.(((.((((((((....)))))))).))).))))))))))....(((....((....)).......(((((........)))))))) {-34.90 d=5.33} [ VIEW IN FORNA ]