Information In Noncoding For ENCR40010084

Accession Number:  ENCR40010084	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0090	Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:611.

Nucleotide sequence:   UCGCGAAUGCCUCUCAGAAACCCCCGAAUUCGGCGUCCGGAUCAUUACGUAUCAUUCAUGAGUAGGUACCUUGCACCACUCAGUACCGGGCGGUACAAGGG

Molecular structure In Noncoding For ENCR40010084

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -28.6 kcal/mol is given below.

.......((((((((((((((......((((((...))))))......))....))).)))).)))))(((((.(((.(((......))).))).))))). (-28.60) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -29.86 kcal/mol.

The frequency of the MFE structure in the ensemble is 12.98 %.

The ensemble diversity is 6.80

.......((((((((((((,,...{{.((((((...)))))).....}),....))).)))).)))))(((((.(((.(((......))).))).))))). [-29.86]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -27.30 kcal/mol is given below.

.......((((((((((((........((((((...))))))............))).)))).)))))(((((.(((.(((......))).))).))))). {-27.30 d=4.53} [ VIEW IN FORNA ]