Information In Noncoding For ENCR40010085

Accession Number:  ENCR40010085	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0009	Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:612.

Nucleotide sequence:   GCCUUGCCGGUCGCCCCCGGCUUUGUUAGCACUCUGAUACCGGUGUCAGGAACACAGAUCGGUUUCUGACACCGGUGGCAAAAAACGAAGACUUCAAGGC

Molecular structure In Noncoding For ENCR40010085

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -42.9 kcal/mol is given below.

((((((((((......))))(((((((.......((.((((((((((((((((........)))))))))))))))).))...)))))))....)))))) (-42.90) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -44.18 kcal/mol.

The frequency of the MFE structure in the ensemble is 12.57 %.

The ensemble diversity is 11.32

((((((((((......))))|((((((.......{{.{(((((((((((((((........)))))))))))))))).},...}))))))....)))))) [-44.18]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -42.80 kcal/mol is given below.

((((((((((......))))(((((((..........((((((((((((((((........))))))))))))))))......)))))))....)))))) {-42.80 d=7.38} [ VIEW IN FORNA ]