Information In Noncoding For ENCR40010086

Accession Number:  ENCR40010086 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0058 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:613.
Nucleotide sequence:   UCCUUCCCCGAUAUCGCUGAGGAAUCCCGCGACGCCCGCUUUGCGCGUGGCGCGUGACGCGCUAGGCUUGGAAUCUCGUUUUCAGUUCGAAGUUUCACGC


Molecular structure In Noncoding For ENCR40010086

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -32.8 kcal/mol is given below.
(((((...((....))..)))))....((((.(((((((.....))).))))))))..(((..((((((.((((..........)))).))))))..))) (-32.80) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -33.85 kcal/mol.
The frequency of the MFE structure in the ensemble is 18.25 %.
The ensemble diversity is 8.43
(((((,..((....))..)))))....((((.(((((((.....))).))))))))..(((..((((((.((({..........)))).))))))..))) [-33.85]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -31.40 kcal/mol is given below.
((((....((....))...))))....((((.(((((((.....))).))))))))..(((..((((((.((((..........)))).))))))..))) {-31.40 d=5.40} [ VIEW IN FORNA ]