Information In Noncoding For ENCR40010087

Accession Number:  ENCR40010087 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0077 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:614.
Nucleotide sequence:   CCCAGAACAUUAACCUCGAAAUCGUAGACGAGACGUCAACCGAAAUACAAUCUAGGGAAGUUUUGGAAGGCCGAUACGAUUUCAGCGCAAGGCGCGGAGG


Molecular structure In Noncoding For ENCR40010087

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -26.1 kcal/mol is given below.
.............(((((((((((((..((....(((..(((((((.............)))))))..))))).))))))))).((((...)))).)))) (-26.10) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -26.49 kcal/mol.
The frequency of the MFE structure in the ensemble is 53.37 %.
The ensemble diversity is 5.50
.............(((((((((((((..((....(((..(((((((.............)))))))..))))).))))))))).((((...)))).)))) [-26.49]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -26.10 kcal/mol is given below.
.............(((((((((((((..((....(((..(((((((.............)))))))..))))).))))))))).((((...)))).)))) {-26.10 d=3.03} [ VIEW IN FORNA ]