Information In Noncoding For ENCR40010088

Accession Number:  ENCR40010088 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0011 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:615.
Nucleotide sequence:   CGAAUAGGCGCCCGAAACAGUCGAAGACCCGGACGCCAAAAGUGUCCGGGGCGACGCCGAGCAAGGUUUUCGCCAAUUGAUUGAGGAAAGGCCCGGGAG


Molecular structure In Noncoding For ENCR40010088

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -36.8 kcal/mol is given below.
......((.(((.....(((((((....((((((((.....))))))))(((((.(((......)))..)))))..)))))))......)))))..... (-36.80) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -37.44 kcal/mol.
The frequency of the MFE structure in the ensemble is 35.22 %.
The ensemble diversity is 5.03
......((.(((.....(((((((...,((((((((.....))))))))|((((.(((......)))..))))}..)))))))......)))))..... [-37.44]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -36.80 kcal/mol is given below.
......((.(((.....(((((((....((((((((.....))))))))(((((.(((......)))..)))))..)))))))......)))))..... {-36.80 d=3.05} [ VIEW IN FORNA ]