Information In Noncoding For ENCR40010089

Accession Number:  ENCR40010089 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0021 Description:   upstream of CCNA_00748
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:616.
Nucleotide sequence:   GCCGAAAGUGGGAGCCGGUUUCGGCGCUCGUCACGCUCUAAGUAUUUGAUUUAGAGCCUUGUCAUCGCGUCGAAACGAUUUCGUUUCGACGCGCAAGGC


Molecular structure In Noncoding For ENCR40010089

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -48 kcal/mol is given below.
(((((((.(((...))).))))))).........(((((((((.....)))))))))((((....((((((((((((....)))))))))))))))).. (-48.00) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -48.93 kcal/mol.
The frequency of the MFE structure in the ensemble is 22.25 %.
The ensemble diversity is 4.69
(((((((.(((...))).))))))).........{{(((((((.....)))))))||((((,...{(((((((((((....))))))))))))))))}, [-48.93]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -47.50 kcal/mol is given below.
(((((((.(((...))).)))))))..........((((((((.....))))))))(((((....((((((((((((....))))))))))))))))). {-47.50 d=3.34} [ VIEW IN FORNA ]