Information In Noncoding For ENCR40010091

Accession Number:  ENCR40010091 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0034 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:618.
Nucleotide sequence:   UUGUCGGGUGCUCGGAAGUCGCCUUGGCGGAGAAAUGACAACGUUGACAUUCUUGUUGACUUGAUGGGGACAUUUCCGGAUUGUGACGGCGUUCGGUGA


Molecular structure In Noncoding For ENCR40010091

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -23.3 kcal/mol is given below.
...(((((((((.....(((((.....((((((.....((..(((((((....)))))))....))......))))))....))))))))))))))... (-23.30) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -26.35 kcal/mol.
The frequency of the MFE structure in the ensemble is 0.71 %.
The ensemble diversity is 37.85
.{{(((({((((,,,,|(((|(|,,,,{{{,,...,,.{{{.(((((((....)))))))}}}.,|,.,,),})))))|...|}},}})))})))}... [-26.35]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -5.80 kcal/mol is given below.
..........................................(((((((....)))))))....................................... { -5.80 d=25.20} [ VIEW IN FORNA ]