Information In Noncoding For ENCR40010094

Accession Number:  ENCR40010094	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0085	Description:   upstream of CCNA_03314
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:621.

Nucleotide sequence:   CUUAGUCCGCUCGUUUUCGCAAUGCGAAAAACUCGCAGCAUCACCGGCGAUGUCAGCGACACGAUUUCAGCCUACAGAGCGUUUCGGAUGAAAUAAUCU

Molecular structure In Noncoding For ENCR40010094

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -23 kcal/mol is given below.

.......(((((.(((((((...)))))))..((((.(((((......)))))..)))).................)))))....((((......)))) (-23.00) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -24.72 kcal/mol.

The frequency of the MFE structure in the ensemble is 6.13 %.

The ensemble diversity is 25.88

.......(((((((((((((...))))}}},,{(((.(((((......)))))..)))).................)))))...,||||......,}}, [-24.72]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -19.90 kcal/mol is given below.

.......(((((...(((((...)))))....((((.(((((......)))))..)))).................))))).................. {-19.90 d=17.32} [ VIEW IN FORNA ]