Information In Noncoding For ENCR40010095

Accession Number:  ENCR40010095	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0005	Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:622.

Nucleotide sequence:   ACUUCAACUUAUCCACAAGGAGCAACAUAACUGGCGAAAUGGAGCAAGAACGAAAAACGAACGUUUCGGGAAAUCUUGCCGUUUACGCAGAGUUACCC

Molecular structure In Noncoding For ENCR40010095

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -20 kcal/mol is given below.

...........(((....)))......(((((.((((((((..((((((.(((((........))))).....))))))))))).)))..)))))... (-20.00) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -21.38 kcal/mol.

The frequency of the MFE structure in the ensemble is 10.73 %.

The ensemble diversity is 9.19

...........(((....)))......(((((.((((((((,.{(((((.((({{..,.....))))).....))))))))))).)))..)))))... [-21.38]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -20.00 kcal/mol is given below.

...........(((....)))......(((((.((((((((..((((((.(((((........))))).....))))))))))).)))..)))))... {-20.00 d=6.07} [ VIEW IN FORNA ]